Histone core phosphorylation regulates DNA accessibility 1 Histone Core Phosphorylation Regulates DNA Accessibility

Nucleosome unwrapping dynamics provide transient access to the complexes involved in DNA transcription, repair and replication, while regulation of nucleosome unwrapping modulates occupancy of these complexes. Histone H3 is phosphorylated at Tyrosine 41 (H3Y41ph) and Threonine 45 (H3T45ph). H3Y41ph is implicated in regulating transcription, while H3T45ph is involved in DNA replication and apoptosis. These modifications are located in the DNA-histone interface near where the DNA exits the nucleosome, and are thus poised to disrupt DNA-histone interactions. However, the impact of histone phosphorylation on nucleosome unwrapping and accessibility is unknown. We find that the phosphorylation mimics H3Y41E and H3T45E, and the chemically correct modification, H3Y41ph, significantly increase nucleosome unwrapping. This enhances DNA accessibility to protein binding by three fold. H3K56 acetylation (H3K56ac) is also located in the same DNA-histone interface and increases DNA unwrapping. H3K56ac is implicated in transcription regulation, suggesting that H3Y41ph and H3K56ac could function together. We find that the combination of H3Y41ph with H3K56ac increases DNA accessibility by over one order of magnitude. These results suggest that phosphorylation within the nucleosome DNA entry-exit region increases access to DNA binding complexes and that the combination of phosphorylation with acetylation has the potential to significantly influence DNA accessibility to transcription regulatory complexes. All eukaryotic genomes are organized into arrays of nucleosomes by tightly wrapping ~147 base pairs of DNA around histone octamer cores (1). In addition to compacting DNA, nucleosomes regulate the occupancy and access of the cellular http://www.jbc.org/cgi/doi/10.1074/jbc.M115.661363 The latest version is at JBC Papers in Press. Published on July 13, 2015 as Manuscript M115.661363 Copyright 2015 by The American Society for Biochemistry and Molecular Biology, Inc. by gest on Sptem er 1, 2017 hp://w w w .jb.org/ D ow nladed from Histone core phosphorylation regulates DNA accessibility 2 machinery involved in transcription, replication and repair to DNA by steric occlusion (2,3). Accessibility of DNA is influenced by ATP dependent chromatin remodelers (4-6), histone chaperones (7-9), and histone post translational modifications (PTMs) (10,11). Nucleosomes spontaneously partially unwrap due to thermal fluctuations, providing DNA binding complexes transient access to sites within the nucleosome (12,13). This occurs most frequently near the DNA entry-exit region of the nucleosome and can be influenced by histone PTMs (14). Histone PTMs function by two general mechanisms. One is a signaling function whereby single or combinations of histone PTMs provide binding sites for recruiting specific regulatory complexes (10,11,15). PTMs located within the accessible histone tail regions of the nucleosome appear to primarily function by this signaling mechanism. The second mechanism is the direct alteration of nucleosome stability and dynamics by single or combinations of histone PTMs (14,1618), which in turn regulates DNA accessibility to transcription, replication and repair complexes. H3K56ac functions by this second mechanism. This modification is located in the DNA-histone interface, about 10 base pairs into the nucleosome. This modification is located within promoters (19,20) and at sites of DNA repair (21); it is involved in nucleosome assembly during replication (22), and enhances transcription (23-25). H3K56ac significantly enhances the probability of DNA to partially unwrap (26) by increasing the unwrapping rate (27), which enhances DNA accessibility to proteins within the nucleosome (28,29). A number of recently identified histone PTMs are also located within the entry-exit region of the nucleosome (30), including phosphorylation of H3Y41 (31) and H3T45 (32) (Fig. 1A). H3Y41 is phosphorylated by JAK2 in human cells and inhibits binding of HP1α (31,33), which is involved in heterochromatin formation. ChIP-seq data indicates that H3Y41ph is present at transcriptional start sites and correlates closely with H3K4 trimethylation, a mark of active genes (34). Since both H3K56ac and H3Y41ph influence transcription, these modifications could occur within the same nucleosome. H3T45 is phosphorylated in human cells by PKCd (32) and DYRK1A (35). PKCd phosphorylation is associated with apoptosis, while DYRK1A phosphorylation represses HP1 binding similarly to H3Y41ph. In budding yeast, H3T45 is phosphorylated by the S phase kinase Cdc7-Ddf4 (36). The level of this modification peaks during DNA replication, and loss of H3T45ph causes replicative defects. The addition of a phosphate group at H3Y41 or H3T45 introduces negative charge and steric bulk near the DNA phosphate backbone (Fig. 1A), potentially disrupting DNA-histone interactions. These observations, combined with previous results that H3K56ac and H3R42 trimethylation increase DNA unwrapping (26,37) suggest that H3Y41ph and H3T45ph may function to directly increase nucleosome unwrapping. Here we report the influence of H3Y41 and H3T45 phosphorylation and phosphorylation mimics on nucleosome unwrapping and DNA accessibility. We find that the phosphorylation mimics H3Y41E and H3T45E, and the chemically correct PTM, H3Y41ph, significantly increase nucleosome unwrapping and increase DNA accessibility to TF binding by about 3-fold. We then investigated the combination of H3Y41ph and H3K56ac. Together they increase DNA accessibility to TF binding by 17-fold. Combined, these studies show that phosphorylation in the nucleosome entry-exit region increase nucleosome unwrapping and DNA accessibility similarly to H3K56 acetylation, while H3Y41ph in combination with H3K56ac can increase DNA accessibility by over one order of magnitude. EXPERIMENTAL PROCEDURES Preparation of DNA constructs − The nucleosomal DNA (Fig. 1) used for SAXS (601147) and MNase (601-207) digestion assays was prepared as described in (38), while the nucleosomal DNA used for FRET measurements (DNA-LexA, Fig. 1) was prepared by PCR as described in (27,28). The template for the PCR was a plasmid containing the 601 nucleosome positioning sequence with the 8th through 27th base pairs replaced with the LexA recognition sequence (TACTGTATGAGCATACAGTA) (13,28). The oligonucleotides used as primers (Sigma Aldrich) in the PCR were Cy3CTGGAGATACTGTATGAGCATACAGTACA ATTGGTCGTAGCA and ACAGGATGTATATATCTGACACGTGCCTGG by gest on Sptem er 1, 2017 hp://w w w .jb.org/ D ow nladed from Histone core phosphorylation regulates DNA accessibility 3 AGACTA. The oligo containing the LexA site contained an amine attached to the 5 prime end and was labeled with Cy3-NHS (GE Healthcare) and then purified by reverse phase HPLC. The 601-LexA PCR product was phenol extracted and then purified by anion exchange chromatography. The 601 sequence is asymmetric in its propensity to unwrap (39,40). Here the LexA site has been introduced on the side of the nucleosome that has a reducing probability to unwrap. Preparation of H3Y41ph with and without H3K56ac − Fully synthetic H3Y41ph and H3Y41ph/K56ac were prepared by sequential native chemical ligation as previously described (28,41) with the following changes. Peptides were synthesized with standard Fmoc-Nα protection strategies using HCTU activation on an AAPPTec Apex 396 automated peptide synthesizer. All Met residues were substituted with Norleucine (Nle) to eliminate oxidative side products. C-terminal peptide H3(91-135)A91C,C110A was synthesized on Rink Amide MBHA resin LL (Novabiochem). Peptides H3(47-90)A47Thz with or without K56ac and H3(1-46) with or without pY41 were prepared on Fmoc-Dbz(Alloc)-derivitized resin as described in (42) and cleaved and purified as the C-terminal N-acylurea derivatives. Synthetic histones were analyzed by RP-HPLC and MALDI-TOF MS (Fig. 2) Histone octamer preparation − Recombinant histone octamers were refolded and purified as previously described (38). The mutations for H3Y41E, H3T45E, H3K56Q, H3Y41E/K56Q, were introduced into the plasmid expressing H3C110A by site directed mutagenesis. Each histone was expressed and refolded into histone octamer following published procedures (38). Refolded histone octamer was purified by gel filtration chromatography. Histone octamer that was to be fluorophore labeled was refolded with H2AK119C and was labeled before gel filtration purification. Histone octamer Cy5 fluorophore labeling − Histone octamers used in the FRET measurements included the H3C110A and H2AK119C substitutions and were labeled with Cy5 maleimide as described (28). Briefly, tris(2carboxyethyl)phosphine (TCEP) was added at 10mM to refolded histone octamer and incubated for 30 minutes. TCEP was then removed by dialysis into 5mM PIPES pH 6.1 with 2M NaCl. The sample was then exposed to a stream of Argon for 15 minutes. HEPES pH 7.1 that was degassed under Argon gas was then added to the sample at a final concentration of 100 mM. Cy5maleimide, which was resuspended in anhydrous dimethylformamide, was then added at 10 molar excess to histone octamer. The labeling reaction was incubated for 1 hour at room temperature, then overnight at 4°C, and then quenched by adding DTT to 10mM. The excess dye was removed during the histone octamer purification by gel filtration chromatography. Nucleosome reconstitution − Nucleosomes were reconstituted with DNA containing the 601 nucleosome positioning sequence by salt dialysis. Nucleosomes used in the SAXS and micrococcal nuclease digestion experiments were prepared as described in (38). The nucleosomes used in the FRET measurements were prepared as described in (27) and then purified on a 5%-30% sucrose gradient. The quality of all nucleosome samples were analyzed by electromobility shift assays (EMSA) on 5% polyacrylimide gels (Fig. 1). The gels of fluorophore labeled nucleosomes were imaged by detecting Cy3 fluorescence with a Typhoon fluorescence scanner (GE Healthcare). LexA Preparation − LexA was expressed in E. coli BL21(DE3)pLysS cells (Invitrogen) from pJWL288 plasmid and purified as previously described (43). Micrococcal nuclease measurements of nucleosome DNA accessibility − Nucleosomes reconstituted with 207 bp DNA that contained a centrally located 147 bp 601 nucleosome positioning sequence were subject to MNase digestion studies. MNase reactions were performed by combining 30 μl nucleosome (20ng/μl) or DNA (20ng/μl) into 2.5ul BSA (10mg/ml), 25ul 10X MNase buffer (NEB), 2ul (200U/μl) MNase, and ddH2O to bring up the total reaction volume to 250ul. 60ul reaction mixture was collected at different time points. The reaction was quenched by 5ul 0.5M EDTA and stored on ice. 4.2ul 10% SDS and 1ul proteinase K (20 mg/ml) were added into each reaction mixture and incubated at 55C for 30min. DNA was isolated by Phenol-Chloroform extraction. The DNA quantity and length following a MNase digestion of nucleosomes with canonical H3, H3Y41E or H3T45E was analyzed by 6% native PAGE (Fig. 3). The relative mobility (Rf) of each DNA ladder by gest on Sptem er 1, 2017 hp://w w w .jb.org/ D ow nladed from Histone core phosphorylation regulates DNA accessibility 4 band and MNase digestion product was measured with ImageQuantTL. The Rf and length of each DNA ladder band was correlated and used to calculate the length of each band observed in the MNase reactions. Size exclusion chromatography with multi angle light scattering (SEC-MALS) − Superdex 200 HR 10/30 column (24 ml total volume, GE Healthcare) was run in-line with the MALS instrument. The flow rate was 0.3 ml/min. 100 μl of nucleosomes at 0.3 mg/ml was injected in a buffer containing 20mM Tris pH7.5, 1mM EDTA pH8.0, 1mM TCEP, 0mM KCl. The same samples were used in SAXS (at a different KCl concentration). The molecular weight for each sample was calculated using the ASTRA software (Wyatt technologies). Small angle x-ray scattering (SAXS) − Nucleosomes containing the 147 bp 601 nucleosome positioning DNA sequence and either wild type (WT), H3Y41E or H3T45E octamers were used in the SAXS measurements. SECMALS (Fig. 4) was used to check the purity and monodispersity of each nucleosome sample. All SAXS data collection was done at the SIBYLS beam line (12.3.1) at the Advanced Light Source (Berkeley). Nucleosomes were either measured in the reference buffer (20 mM Tris-HCl, pH7.5, 1 mM EDTA, 1 mM DTT) or in the reference buffer with 50mM KCl to investigate the influence of ionic strength on nucleosome structure. In order to optimize the data quality and minimize radiation damage, exposure series of 0.5s, 1s, 2s, 6s were performed. Data were processed by PRIMUS (44). The dimension of nucleosomes was estimated by GNOM (45). Ten random molecular envelopes were constructed for each nucleosome by DAMMIN (46). They were superimposed by DAMSUP (47). The average molecular envelopes of these 10 random models was calculated by DAMAVER (48). The averaged model was filtered by DAMFILT. Convex shells of all models were built and visualized (Fig. 5, (49)). For radius of gyration (Rg) determination, data from 1/16 dilutions, exposed for 1s were used. This provided strong data at low angle with minimal inter-particle repulsion due to the charged nature of the nucleosomes. A typical example for WT was collected at approximately 0.1 mg/ml. Data from replicate experiments were evaluated simultaneously for each individual mutant. Radius of gyration values were calculated by Guinier analysis (50), with a new algorithm (to be described elsewhere) applied to the triplicates of experimental scattering data. The algorithm optimizes a bias-variance tradeoff criterion and allows us to determine Rg values at higher precision than previously possible, while at the same time providing statistically well-founded uncertainties. Fluorescence resonance energy transfer measurements of DNA unwrapping − FRET efficiencies were determined from fluorescence spectra as previously described (27). Fluorescence spectra were measured with a Fluoromax-4 (Horiba) photon-counting steady-state fluorometer at room temperature (Fig. 6). The Cy3 donor fluorophore was excited at 510 nm and the fluorescence emission was measured from 550 nm to 750 nm. The Cy5 acceptor fluorophore was directly excited at 610 nm and the fluorescence emission was taken from 650 nm to 750 nm. From these fluorescence spectra the acceptor emissions due to donor and acceptor excitations were determined. Fluorescence emissions (F) were measured by integrating the fluorescence spectrum from 656 nm to 674 nm after subtracting out the fluorescence spectra of the sample buffer without nucleosomes. The FRET efficiency, E, was then calculated via the (ratio)A method as described previously (51) with E = 2(ε610 F510 / F610 ε510)/(ε510 d). The superscripts refer to the donor (D) and acceptor (A) fluorophores and the subscripts refer to the illumination frequencies 510 nm for donor excitation and 610 nm for direct acceptor excitation. A prefactor of 2 reflects the presence of two acceptor molecules per donor molecule. F510 is the fluorescence emission of the acceptor after the subtraction of overlapping donor emission when excited at 510 nm. F610 is the fluorescence emission of the acceptor when excited at 610 nm. ε610, ε610 and ε510 are the molar extinction coefficients of acceptor and donor at 510 nm and 610 nm. d is the donor labeling efficiency, which is 1. Measurements of LexA binding within the nucleosome − LexA binding is detected by measuring a reduction in the FRET efficiency that is caused by LexA trapping the nucleosome in a partially unwrapped state. To quantify changes in LexA binding, we performed LexA titrations from 0 to 10 μM with 5 nM Cy3-Cy5 labeled by gest on Sptem er 1, 2017 hp://w w w .jb.org/ D ow nladed from Histone core phosphorylation regulates DNA accessibility 5 nucleosomes in 0.5x TE with 75mM NaCl. Each 20ul sample was incubated for 3 minutes before taking an emission spectrum in the fluorometer at room temperature. For each data point, a corresponding blank spectrum was taken with the same LexA concentration to correct for background fluorescence. The FRET efficiency as a function of LexA concentration was fit to a noncompetitive binding curve, E=EF+ (E0−EF)/(1+[LexA]/S1/2). Where E is the FRET efficiency, S1/2 is the concentration at which the FRET efficiency has decreased by half, and E0 and EF are the initial and final FRET efficiencies. For each modification and mimic studied, we determined the relative S1/2 = S1/2 mod/S1/2 unmod, which is inversely proportional to the relative change in the probability that the LexA target site is accessible for binding. Each titration was taken in triplicate and the standard deviation of the three measurements was used as an estimate of the measurement uncertainty. RESULTS H3Y41E and H3T45E Increase Nucleosome Unwrapping. − To investigate if phosphorylation of residues at the DNA entry/exit site affects DNA unwrapping and enhances accessibility within nucleosomes, we first prepared histones with individual H3Y41E and H3T45E substitutions. The glutamic acid introduces a negative charge that mimics certain aspects of phosphorylation. Nucleosomes were reconstituted with histone octamers containing these mutations, and 207 base pair DNA molecules where the central 147 base pairs contain the 601 nucleosomes positioning sequence (NPS) (52). This allows for reconstitution of homogeneously positioned nucleosomes (Fig. 1). To determine whether H3Y41E and H3T45E increase DNA unwrapping, we first assessed their impact on the rate of micrococcal nuclease (MNase) digestion of nucleosomal DNA. MNase cleaves linker DNA, but pauses when encountering histone-bound DNA, resulting in the protection of a ~150 base pair DNA fragment. Transient unwrapping of DNA from the histone octamer surface allows MNase to proceed further into the nucleosomes, resulting in increased rates of cleavage and smaller products. We analyzed the MNase digestion time course of naked DNA, unmodified nucleosomes, and nucleosomes containing either H3Y41E or H3T45E by polyacrylamide gel electrophoresis (PAGE, Fig. 3). In unmodified nucleosomes, we observe a single 165 bp band after 60 seconds of MNase digestion which is further digested to a ~ 140 bp fragment, corresponding to the nucleosome boundaries. (12,13) In contrast, MNase digestion of nucleosomes containing H3Y41E or H3T45E did not result in a well-defined 150 bp fragment. Instead, a distribution of shorter DNA lengths were produced following a 60 second MNase digestion, while a 120 second digestion converged to a ~ 120 bp fragment (Fig. 3B). This reduction in the length of DNA protected from MNase digestion by the histone octamer is a strong indication of increased DNA unwrapping. By comparison, crystallographic analysis of nucleosomes containing the H3 histone variant CenpA shows no changes in structure apart from the disorder observed for the last 10 base pairs on either end (55). Single molecule measurements have shown that CenpA containing nucleosomes have increased exposure of terminal DNA and protect ~120 bp of DNA from MNase digestions (56). Combined, this indicates that MNase has increased access to DNA within nucleosomes containing either H3Y41E or H3T45E, suggesting that theses phosphorylation mimics increase DNA unwrapping from the histone octamer. To further investigate the influence of H3Y41E and H3T45E on overall nucleosome structure, we carried out size exclusion chromatography coupled to multi-angle light scattering (SEC-MALS), and small angle x-ray scattering (SAXS) measurements. Nucleosomes were reconstituted with 601-147 DNA (Fig. 1B) and unmodified histones or histones containing either H3Y41E or H3T45E. SEC-MALS confirmed that nucleosomes reconstituted both with and without these modification mimics were monodisperse, and had the expected molecular weight of ~200 KDa (Fig. 4). This verifies that nucleosomes with these amino acid mutations form canonical nucleosomes and not aldered DNA histone complexes such as the altosome (53,54), or nucleosomes lacking histones. SAXS measurements allow us to determine the molecular envelope and radius of gyration (Rg), which is defined as the average distance from the center of mass for the ensemble of molecules (Fig. 5A). At low ionic strength, unmodified by gest on Sptem er 1, 2017 hp://w w w .jb.org/ D ow nladed from Histone core phosphorylation regulates DNA accessibility 6 nucleosomes have an Rg of 43.1± 0.15 Å, consistent with published data (49), while nucleosomes with H3T45E and H3Y41E both have statistically significant increased Rg values. This effect is more pronounced for H3T45E at 50 mM salt. This is also apparent in the molecular envelopes calculated from SAXS data collected at low ionic strength, which are consistent with increased DNA unwrapping from the entry-exit region of the nucleosome (Fig. 5B). These results provide additional evidence that phosphorylation of the H3 residues around nucleosome entry-exit region increase DNA unwrapping to enhance accessibility of proteins to DNA sites within the nucleosome. H3Y41 phosphorylation, H3Y41E and H3T45E each increase DNA accessibility within the DNA entry-exit region of the nucleosome. − We next considered whether the increase in nucleosome unwrapping detected by MNase and SAXS measurements might enhance the interaction of proteins with DNA within the entryexit region of the nucleosome. To investigate this, we used a FRET based assay developed by Widom and coworkers (13), modified to assess the impact of histone PTMs on DNA unwrapping (27-29). In this assay, the recognition sequence of a model transcription factor, LexA, is introduced near the DNA entry-exit region of the nucleosome such that LexA binding is occluded in the wrapped nucleosome state but accessible in the partially unwrapped state. The nucleosome is reconstituted with the 601-LexA DNA molecule, in which the 8th through 27th base pairs of the 147 bp 601 NPS are substituted with the LexA recognition sequence (Fig. 1B). The DNA molecule is labeled with the Cy3 donor fluorophore at the 5 prime end near the LexA site, while the histone octamer is labeled at H2AK119C with the acceptor fluorophore, Cy5. In the fully wrapped nucleosome state, the Cy3-Cy5 pair exhibits energy transfer, while a partially unwrapped nucleosome that is trapped by LexA binding generates a significantly lower energy transfer efficiency. As LexA is titrated from 30 nM to 3000 nM with a fixed nucleosome concentration of 5 nM, LexA binds its recognition site and traps nucleosomes in a partially unwrapped state. A LexA titration with these Cy3-Cy5 labeled nucleosomes results in a decrease in FRET efficiency. This can be fit to a non-cooperative binding isotherm to determine the S1/2, which is the concentration of LexA where 50% of the nucleosomes are bound (Fig. 6). A change in the S1/2 is a quantitative measure of a change in the accessibility of the LexA target site, such that a decrease in the S1/2 implies an equal increase in the LexA site accessibility (13,27). We carried out LexA titrations with nucleosomes containing the phosphorylation mimic H3Y41E, and found that it decreased the S1/2 by 2.8 ± 0.4 fold. Since glutamate is chemically distinct from phosphotyrosine, we prepared the modified protein H3Y41ph using sequential native chemical ligation (Fig. 2). We find that H3Y41ph decreases the LexA S1/2 by 3.1 ± 0.4 relative to unmodified nucleosomes. This suggests that within error H3Y41E accurately mimics the influence of H3Y41ph on the probability of LexA binding to its DNA target site (Fig. 6, Table 1). This change in probability is related to the change in the free energy difference between the exposed and unexposed state by ΔΔGPTM = -kBT ln (S1/2 PTM / S1/2 unmod) and implies that ΔΔGY41ph = 1.1 ± 0.1 kBT = 0.7 ± 0.1 kcal/mol. We next investigated the impact of the phosphorylation mimic H3T45E, which organizes the same DNA minor grove as H3Y41. We found that the glutamate substitution for H3T45 decreased the S1/2 by a factor of 2.2 ± 0.5, which is similar to the reduction observed for H3Y41E, H3Y41ph, H3K56Q, and H3K56ac (Fig. 6, Table 1). We conclude that phosphorylation at H3T45 is likely to increase site exposure for DNA-protein binding within the entry-exit region of the nucleosome similarly to phosphorylation at H3Y41. Furthermore, the similarity between histone modifications in the entry-exit region (Fig. 6, Table 1) suggests that single histone PTMs in this region tend to increase DNA accessibility by about a factor of 3, irrespective of the precise location and nature of the modification. The combination of H3Y41ph and H3K56ac multiplicatively increases DNA accessibility − Nucleosomes often contain combinations of histone PTMs (11). We considered the possibility that H3Y41ph and H3K56ac could occur within the same nucleosome since they both are involved in transcriptional regulation and have been identified by ChIP-seq to occur within nucleosomes around transcription start sites (19by gest on Sptem er 1, 2017 hp://w w w .jb.org/ D ow nladed from Histone core phosphorylation regulates DNA accessibility 7 22,31,33,34). We therefore constructed H3Y41ph/K56ac histone by sequential native chemical ligation. We then prepared Cy3-Cy5 labeled nucleosomes containing the 601-LexA DNA sequence with histone octamer containing H3Y41ph/K56ac. We assessed via FRET the S1/2 of LexA binding to its site in partially unwrapped nucleosomes. We find that the S1/2 of LexA binding to nucleosomes containing H3Y41ph and H3K56ac was reduced by a factor of 17 ± 5 relative to unmodified nucleosomes (Fig. 7, Table 1). This implies that these two modifications in combination dramatically increase the probability that a DNA target site within the entry-exit region is exposed for DNA-protein binding relative to either modification alone. We compared this S1/2 for LexA binding to nucleosomes containing both H3Y41ph and K56ac to the LexA S1/2 with either individual PTM. If the two PTMs independently influence LexA binding, each individual ΔΔG should combine additively, i.e. ΔΔGY41ph + ΔΔGK56ac = ΔΔGY41ph/K56ac, and each individual relative S1/2 should combine multiplicatively, i.e. !! ! !!"!! !! ! !"#$% !! ! !!"!"